C++

Language c++ only can use (If else statment, for (while) loop, array, function,vector)

#include
#include
#include
#include
#include
#include

mRNA molecules are created from a single strand of DNA, through base pair matching with one exception. Instead of Tyhmine, mRNA has a base called Urasil (U).

For example: If the DNA strand has the following bases ATGCCCGTTA, its corresponding mRNA is UACGGGCAAU. A is paired with U, T is paired with A, C is paired with G and G is paired with C.

After mRNA is transcribed, it is translated into codons which are triplets of bases. Each codon has a special meaning and corresponds to a specific aminoacid. Then, aminoacids are sequenced to create a protein.

How do we indicate the start and end of an aminoacid sequence? As it turns out, some codons are reserved to indicate this. For example, AUG codon indicates the start of the protein synthesis, while three other codons indicate the end: UAG, UGA, UAA.

The first file ecoli.fa is a FASTA file which contains the DNA sequence data. Here is an excerpt from the file:

>Chromosome dna_rm:chromosome chromosome:ASM584v2:Chromosome:1:4641652:1 REF AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTC TGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGG TCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTAC ACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGT AACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGG CTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAAGTTCGGCGGT ACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCC AGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTG GCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAA CGTATTTTTGCCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCG CAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCTGCATGGCATT AGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCTGATTTGCCGTGGCGAGAAA ATGTCGATCGCCATTATGGCCGGCGTATTAGAAGCGCGCGGTCACAACGTTACTGTTATC GATCCGGTCGAAAAACTGCTGGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCT GAGTCCACCCGCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGATGGCA GGTTTCACCGCCGGTAATGAAAAAGGCGAACTGGTGGTGCTTGGACGCAACGGTTCCGAC TACTCTGCTGCGGTGCTGGCTGCCTGTTTACGCGCCGATTGTTGCGAGATTTGGACGGAC GTTGACGGGGTCTATACCTGCGACCCGCGTCAGGTGCCCGATGCGAGGTTGTTGAAGTCG ATGTCCTACCAGGAAGCGATGGAGCTTTCCTACTTCGGCGCTAAAGTTCTTCACCCCCGC

The second file in the project folder is a CSV file named codon_table.csv which contains the codon list. Here is an excerpt from the file:

Codon

AA.Abv

<

td>AA.Code

AA.Name 

UUU




Phe



    F



    Phenylalanine




UUC



    Phe

F 

   Phenylalanine



UUA




   Leu



    L



    Leucine




UUG



    Leu

L 

   Leucine



CUU




   Leu



    L



    Leucine

In the above table, AA.Abv represents the abbreviation of the aminoacid, AA.Code represents the code for the aminoacid and AA.Name represents the actual name of the aminoacid. There are 64 codons in the file. One aminoacid can be represented with multiple codons, they all create the same aminoacid. For example, both UUU and UUC codons are translated as phenylalanine.

Write a function transcribe(dna_string) that creates the mRNA string from the DNA string. Each base in dna_string must be matched to its corresponding mRNA base. There might be strange characters in the DNA string other than A, T, C, G. They should be ignored: A  U, T  A, G  C, C  G matchings are the only valid ones.

string transcribe(string dna_string){
//this function must take the DNA string and construct a new mRNA string

//then return the mRNA string

}

Write a function translate which accepts the mRNA string as a parameter and creates a string vector of proteins. Each item in the vector is a string that consist of the aminoacid codes of the protein. The function must return the protein vector as a result.

Each protein’s aminoacid sequence starts with M (Methionine) which is the starting aminoacid and ends with a Stop aminoacid. So the function should:

look for mRNA sequences that starts with AUG codon;
detect the end (UAG, UGA, or UAA codon);
in between, identify the corresponding aminoacids for the codons to construct the protein;

save the protein string in the vector(Use push_back function).

vector translate(string mrna_string) {

//create a protein vector and return it. }

Use the following print and main function to connect the processes and print the resulting protein vector

void print_protein_list(vector list) {

   for(string line : list)



    {




       cout << line << endl;



    }

cout << list.size() << " proteins listed" << endl; }

int main() {

string dnastring = readFastaFile(“ecoli.fa”);

readCsvFile(“codon_table.csv”);
string mrnastring = transcribe(dnastring);

vector protein_list = translate(mrnastring);

print_protein_list(protein_list);

return 0; }

The first few lines of the output should look like this:

0 -> MDGTHLILKStop
1 -> MKLVISVSRVCLFLMSHVLStop
2 -> MVVVVVMVSIATPDCACPLCLFSGVDCHARKKKLVSIAPLLVRSQLQAAMStop
3 -> MGYSRYGLHKNGLKTALSGGGSAPRATALTFESSStop
4 -> MTIARPAFStop
5 -> MELRWQLStop
6 -> MRRRHDRRTNARLTTLStop
7 -> MDAGRSPRATLQQLQLQDGPSLPRKDEAAISRSGGVVMGVAGQGLGNGLIFMAFRSSWSMRVTTVGTTSAStop 8 -> MRStop
9 -> MSStop
10 -> MDLDFLPNDLGDRHCLADRStop
11 -> MSSLRQVMASPIASQTLTAATATATRRPRStop
12 -> MHRRHNGStop

….

Office Talk Microsoft Access

 

Describe a database that might be used in your current or future career. Using this data, explain the relationship between a field, a record, a table and a database (do not provide the definition of these terms).  In addition, what are the advantages of managing database information in Access versus using a worksheet in Excel?

HW

 

This assignment consists of two questions to test knowledge and assimilation of the course objectives.

  1. Name and discuss one key element in national cooperation on airport security since 911 and one key element of international cooperation on airport security since 911. Discuss the potential pros and cons of each.
  2. Identify, explain, and discuss two processes and/or technologies you believe can, or will, fundamentally change airport security over the next decade.

Technical Requirements

  • Your paper must be at a minimum of 2-3 pages for each question for a total of at least 4-6 pages (the Title and Reference pages do not count towards the minimum limit).
  • Scholarly and credible references should be used. A good rule of thumb is at least 2 scholarly sources per page of content.
  • Type in Times New Roman, 12 point and double space.
  • Students will follow the current APA Style as the sole citation and reference style used in written work submitted as part of coursework.
  • Points will be deducted for the use of Wikipedia or encyclopedic type sources. It is highly advised to utilize books, peer-reviewed journals, articles, archived documents, etc.
  • All submissions will be graded using the assignment rubric.

You are a network consultant for

 You are a network consultant for a large consulting firm. You are going to design a large network for an enterprise client that sells gourmet candies. The network is going to be for their entire US-based operation. There are seven physical sites to this network, located in New York, Boston, Atlanta, Chicago, Dallas, Los Angeles, and Seattle. The information for each physical site is given below:
 

Site Total Number of Clients Additional Information
New York 1100 WiFi at site, heavy printing needs
Boston 600 WiFi at site
Atlanta 400 public website hosted at this site with e-commerce
Chicago 800 WiFi at site, developers are located at this site
Dallas 500 credit card processing done here
Los Angeles 1000 WiFi at site
Seattle 600 shipping and distribution site is here
 

Deliverables:
 

Your final design must contain:
 

1. A drawing of the overall network with general information so I can see the physical layout of your network. All physical sites should be on this diagram so I can see the “big picture.” You should display the internet connections and their speed, as well as how you choose to connect each site together.
 

1. After completing the physical layout of the network, you will choose a specific site and do a detailed design of that site, similar to the earlier project. You should be absolutely as detailed as possible, including not only a sound physical design, but also a detailed backup and recovery plan. Make sure you are thorough and complete!
 

1. The final part of the project requires you to write a complete analysis of your design, explaining why you chose this particular layout, justifying all of your choices. The writeup has no particular length requirement; however, a good and thorough explanation will likely be at least two to three pages.

 

os

Consult current literature to further explore the status of WiMAX technology. Describe any barriers to commercial use and the applications that show the most promise. Explain which countries expect to benefit the most and why

Case Study

 

Martin and Carrie Moss are a married couple. They both worked for an advertising firm for 25 years. At age 47, Martin and age 42, Carrie retired and moved to the small town of Pahrump, NV, which has a population of approximately 6,500 residents. When the Moss moved to the town, they decided to start a daycare business in their home called Gram’s Haven.

            Gram’s Haven is licensed by the state. The state charges an annual fee of $225 to maintain the license. Insurance is required for $3,840 annually. The facility is licensed to care for a maximum of six children. The Moss charge a fee of $800 per month for each child. The monthly fee is based on a full day of care, from 8:00 a.m. to 4:00 p.m. If additional time is required beyond 4:00 p.m., parents must pay an additional charge of $15 per hour for each child. The couple provides two meals and a snack for the children. The cost of the meals and snacks is $3.20 per child per day. There are six children currently enrolled.

            The facility is very nice. It is an 820 square foot addition to their home that was built in 1964. The Moss purchased the home and completed the renovations for $79,500, and they believe the addition has a useful life of 25 years. The facility has a large open space for play, reading, and other activities. There is a section for sleeping which contains small cots. The facility is equipped with a small kitchen, two bathrooms, and a small laundry area. The daycare increased the Franks’ utility cost by $50 each month.

            During the first week of operations, the washer and dryer stopped working. Both appliances were old and had been used by the couple for many years. The old appliances cost a total of $440. While a laundry room was not initially necessary, it became increasingly important for laundering the soiled clothes of the children, blankets, and sheets. A company nearby, Sagan Laundry and Dry Cleaning, can launder clothing for the Moss, including pick-up and delivery, for $52 per month. Alternatively, the Moss can take clothes to the laundromat once a week, three miles away (one way). The applicable mileage rate is $0.56/mile. They can launder the clothes themselves for $8 per week. The self-service alternative does not include detergent or fabric sheets. The couple would need to purchase these items to use the laundromat. Purchasing laundry supplies in bulk from WashMart would cost $35 every quarter. The final alternative is for the Moss to purchase a washer and dryer. The cost of the appliances is: washer $420 and dryer $380. The additional accessories for both appliances, needed for installation, cost $43.72. The store will deliver the appliances at a total cost of $35. The cost of installing the appliances is free. Both appliances are expected to last eight years. According to the manufacturer, the washer will increase energy costs by $120 per year. The dryer will increase energy costs by $145 per year.

The Moss needs some assistance in decision-making and evaluation. They have contacted Miranda Hobson, their accountant, to provide some advice.

Requirements

Respond to the following Case Discussion Questions to help Martin and Carrie make their decisions.

Case Discussion Questions:

(If necessary, the Franks will use straight-line depreciation. For monthly calculations, use 4.33 weeks per month.)

1. Consider the different types of costs discussed in our course BACC531, Managerial Accounting. List all the costs you can identify as discussed in the case; provide one specific example of each and brief reason why to classify as such. An example is provided below.

Cost  Specific Example  Reason

Fixed cost                    Annual license fee of $225            The license fee does not change regardless                                                                                                 of activity

2. Based on the information provided, what information is relevant to purchasing the appliances? What information is irrelevant to the decision to purchase the appliances? Why? Are there any other cost concepts you can derive that are not explicitly addressed in the case?

3. What could it cost the couple to launder clothes? Show your detailed calculations for each.

4. The couple has made a significant investment in this business. How long will it take for the couple to recoup their investment? Is the time required to recoup the investment a good measure of the success of the company? If not, how would you measure the success of the company? Explain.

5. As Miranda Hobson, prepare a letter to the Moss advising them on their laundry needs. What is your recommendation and why?

6. The Moss has a wait list for their daycare. They can hire an employee for $9 per hour for 40 hours each week. With the additional employee, the Moss can accept three additional children. Should the Moss hire an additional employee? Show your detailed calculations.

7. The Moss’ home can accommodate a maximum of nine children. They can move the daycare from their home to rented space in town, which can accommodate up to 14 children. The space will cost $650 per month, and the utilities will cost $125 per month. Additionally, insurance will now cost the Moss $5,000 per year. Per Nevada state regulations, each adult can supervise no more than three children. Assume you are Miranda Hobson, prepare a letter to the Moss advising them on their space options. Should they continue to operate the facility at home, or should they rent space in town? How many children should they accept? How many employees will they need to hire? Show your detailed calculations for each scenario.

Please note:

***You are required to submit this paper in APA style, 7 th Ed. Your paper should be formatted with double spacing, one-inch margin, and headings, and subheadings. Please make sure to provide citations and attributions.

***Make sure you have a title page, running head, page number, abstract with keywords, introduction, and reference page.

***There is no limitation on the number of pages for this project.

Why Adjustable Computer Desks are a better choice for Offices?

Office desks are designed to be a sedentary environment. However, there are many benefits of standing desks that make them better for your health. Standing desks can help reduce obesity and diabetes by improving metabolic rates. They also provide better posture which reduces the risk of neck and back pain Additionally, they improve focus by providing more natural movement which can lead to increased productivity.

An adjustable computer desk is a versatile furniture that can be used in various ways to promote the health and wellbeing of both employees and office visitors.

The New York Times published an article about how “participants burned an average of 4.2 calories per minute when they were standing on a curved computer desk while working, compared to 2.9 calories per minute when they were seated.” This means that if you’re looking for some extra motivation to get your work done, stand up while you’re working on your adjustable computer desk!

Adjustable computer desks are the perfect solution for anyone who wants to keep active while working. A study found that people who work on an adjustable computer desk burn off more calories than those who work on a traditional desk. They also found that the participants were more likely to stand up and move around or walk around their office during their day.

With the increase in weight these days, many people are looking for ways to burn calories without having to exercise. One way is by standing on an adjustable computer desk. Sitting all day long at a desk can lead to health problems like heart disease, obesity, and diabetes. Standing desks are becoming more popular in offices nowadays, but many don’t know that adjustable computer desks are better than standing desks.

Adjustable computer desks allow you to sit or stand while working or playing games on your PC. Adjustable computer desks also give you the option of using a chair when your feet need a break. Many people have trouble focusing on what they are working on due to physical discomfort. Adjustable desks can be an easy solution to this by allowing the user to adjust the height, position, and even the distance of their monitor. This is because it’s likely that an adjustable desk will better accommodate your physical needs specifically.

To know more about the right tools for the office, one should give a look at this >> computer supply store